1 GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGTGATCTGAAAT 60   
   61 AAAATGTCTCAAAAAAATAGAAGAAAACATTGsean eddy's home page.TTTCAA 120  
  121 AATTTTCTGACATACCGTTTTGCTTCTTTTTTTCTCATCTTCTTCAAATATCAATTGTGA 180  
  181 TAATCTGcontact info.GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGA 240  
  241 GAACTTTTGAATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG 300  
  301 AACATCGAATGAAGATAATTTTAATTblog.GTTACAGTTTTTCCTCCGACAATTCCTGA 360  
  361 TTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGATGCTCTTCTAGGAGGATGTT 420  
  421 GAAATCCGAAGTTGGAGAAAAAGTTCTCTCAAlab home page.CTTCGTGGATCCGA 480  
  481 TTCAGATGGACGACCTGGCAGTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGG 540  
  541 CGTGAAACACAAAGGGTATobtaining reprints & lab publications.ATC 600  
  601 CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAAAAATTATCTA 660  
  661 GGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTThmmer.CGGTAAATCCTTCAAA 720  
  721 AACTCCATAATCGCGTTTTTATCATTTTCTAACACATATTGACCATTTGGTTTGTTCAAA 780  
  781 TCAGAACAAATCTTAGCGAGCATAAAGpfam.TGCGATTCCAGCAGAACATGTTAATCCC 840  
  841 GTGAGTTGTTCAACTCGAAATCGAATTTCTCGAACAGCCTCCTCTCGTCCAGTTCCGAAC 900  
  901 TCCACATGGTCGTAGTAGinfernal.GATTTTTCGCATTTTGGACAGATCGATTCTTCG 960  
  961 ATTTTCAAGTCTTCCAAAGTATTTTCATTCTCGTCGAAACGGGGTAACCAACATGGACAA 1020 
 1021 TCrfam.CGAATCTGTGACGCTTGAAGGTTTCTAGTAAGCAAATAGTTTTTTGTTAATAA 1080 
 1081 TCAAATCTAAATCACTAACTTTTTTCTGTATTACTTGCCACATAGTCTGTCAAATCTATA 1140 
 1141 AATGCCTCATCCAATGACATCATbiological sequence analysis.TTTGTGAA 1200 
 1201 AATTGGCGACTGACTTTAGTGTATTTAGGGTAATTTCCTGGAACAATCGTTAGACTCGGA 1260 
 1261 Cmy links.TTGAGATGAAGCCAGGCATTCCAGCACGGACTCCAAAACGGCGAGCCAAG 1320 
 1321 TAGTTGGATGTGCTCTGAAAGAATAGATTTAAAGCTTTTCCGAAATCGAAAATTTACTTT 1380 
 1381 TCAAATTGAGTTAGGTGCTTACCAGCATTGcv.ATGAGCCTACGGCCATAGGAACTGTTC 1440 
 1441 TCAGTGCAGGATTATCTCTCATTTCAACTGCGGCAAAATAAGCATCCATATCTATACAAA 1500 
 1501 CACAGTCTCTTGATAAATCTCTAGATGATTCCAGTTTCATCTCAAGATTCTCCATCTGAA 1560 
 1561 AATTGGAAATTTGCTCTAAGTAAATTTATTAGCTTTTAAAATACATACCAGTATCTCAGA 1620 
 1621 TTTTTGTCTTTCTTCTCTGGTTGCTGTTTGCAAACGATTTTTGATTTCTAAAACTTTCTC 1680 
 1681 TTCAATTCTTGATTGTTGTTTTTTGGAAAACGACGAGTAGGACGCTGATGTGTTTTCTTC 1740 
 1741 GATGACTTTCGTGATTTTCTCCTTATCCAGTCCATTCATTCCAGCTTTATTATCGTTGAA 1800 
 1801 AGTCAGCATTTTTCACGAAAAAGAGCCGGATTTTGAAATTCGCGGAGAAACTCCACTGAT 1860 
 1861 TGTGAGTGTGCAAATGCGCGTAATGGTGTACTTACGTACATCGGCAACACATTTGACGAC 1920 
 1921 ATATCAGAAAGCGGCGCCAAATTAGAAGTTGAGTGCGCGAGAAAAAACTACGCGTTAACC 1980 
 1981 GCCAATTTTCACTTCCCCACAGATCTGTCTCGAGATTCTCGAGTCATTTTTCAAGTTTAT 2040 
 2041 TTGTTTGTCAGCGGTTGTTTTATTGAAGATTTGTAAAATTTATAACAAAATGTGCAATAG 2100 
 2101 TCTATTAAACCTCGTGAGATATTTGAAGAAACTTTCCCCGTTTTAAATATTTCGTGTATT 2160 
 2161 CGTGGAGATCGCGGGAATGTTTTGCCTGTTTCCGTAAAATTCCTCTATTTCTTTTATTTT 2220 
 2221 TGCTTGCAATTTTCGATTCATTTCAGAAGTTTCCACATTCGCAAAACGAATGGACGTCTC 2280 
 2281 TTATTACGATGGTCCCAAGGATGAAGTCGCCGAAGCAATGCTGAAAAGCGCGGTGACGGC 2340 
 2341 CATGAGATTGGGACAATACGAGGATGGAAAAGGACGCTTAGAGGAGATAATGGAGTTCGG 2400 
 2401 AACCTCAAATTTTCAACTACTTGGTACAATCTACATGTATTACGGAAGAGTGTGCAGGCA 2460 
 2461 TTTGAACCATGATGCCAAGGCCTTGGAGTTTTTCGAACATGAGTTGAACATGTTCAAGTA 2520 
 2521 AGTGAATCACAAAAATGAGCTGGACATTCTATAACCTTAATTTTTCAGATTGATCTTCAA 2580 
 2581 CTACCCAGAAGCATGTGATTCCACACGTCGCATCGTCGAGCAGGCACTCAAAATGGGAAA 2640 
 2641 GTTCCCCAAGGCTCGACGGTTTGCTGAGGATCTCATTGATTACACCAGCAATAAGAAGAA 2700 
 2701 CGGAGAGAAGTATATCGGTCAAGCTCGAATTTTGTTCGCTTCCGTGTGCCTCGAAGGATG 2760 
 2761 TGAAAGAGACGTCGAGAGTAATCAAGATGAGAAGAAGAAGCTTTTGTCAATATGTGCTGA 2820 
 2821 ACAGATTGCAGCCGTGAAATTGTTCAACGAGAATAATACGGAAGGAGCTGTGTCTGAGAC 2880 
 2881 CAAAATCATGTTACTTGAGGCGAAATGCTTGTCACTAGACGAAAAATACGAGGAATCGCG 2940 
 2941 TCGCAAGTATCAAGAATGCATCGATTTTGCCATCAAAACAGACCAGTTTGAAGCAGTTCA 3000 
 3001 CATCGCCTATTACGACAAGGCTCTATATGCTGAGACAGATCTTCTTTTCTTTATTATCAG 3060 
 3061 AGATCTCAGGTAATTTTTAGTTTTAACGATTAATAAAAATATCAATTCTTTATTCACAGA 3120 
 3121 AGTGCTCTCTTCTACGCCACGAAATTCGGAAAAGAGCGAGATGTAGTCAAATATAAGTCG 3180 
 3181 AAGCTATCCGAAGAGATGCTGAGAAATGGCGAATTCCACGAAGCATATCTCTACGGATTG 3240 
 3241 GAAGCGCTTGTATCGATTCGGAAGCTTGGATTGAACGAATACATTGGAGATGTGTTGCTT 3300 
 3301 ACAATCGCAAAGTGCCTCATTGCACTTGGAAAAAGACGCCAAGCTGCTTATTTTATCATC 3360 
 3361 TTGGGGAGTGTTCTGACCATCAACCAAAACAGTTTCAAACTGTTCTACGAGCAGATCGAC 3420 
 3421 GTGGCGATGAATCAAGAGAGAAGCGAAACGGCAACTGATCAAGATGTATGCCTCGCAATT 3480 
 3481 GATTCGTCTCCTGATCCGACATCCTCGAATGACATGATTAATAAGTTCGTCGTCGAACTG 3540 
 3541 GAGCACGCAACAAATGTGGAAACCTGGGAAATGATTGTCAACGGAATCATTGACGACCAG 3600 
 3601 AAGAAACCAGTGGCGATCGAAAAGAAAGAGAACGAGGAACCCGTAGACATGATGGATCTC 3660 
 3661 ATTTTCAGTATGAGCTCACGTATGGATGATCAAAGAACTGAACTGCCTGCTGCCAGATTC 3720 
 3721 ATTCCGCGTAAGAAATGTTATAAATAAGCGTATAAGTATGCAAATTTATATTTTTCCAGC 3780 
 3781 TCGTCCAGTGTCATCGGCATCGAAAAAGACTACAAAGAGTCACAGAATCCTCCCTGGACT 3840 
 3841 CCGTGCCAATTGGACAAAAGTGCAGTCGATGAAGTTCGATGGTCACACAATGAATAGGAT 3900 
 3901 CCTGAAGAGGTCGAAGAAAAGCAAATCGTCATTGGATTCTACAAATTCGATGCAGGGCGA 3960 
 3961 TGATACTCGAAGCGATGATGTGACAATGACGTCCAAATAGGACCATTATTTTTTCTGTCA 4020 
 4021 AATAATACAATCAAACTTTCTTTATTTATTTTTTTTTTACTTTCTTTCAGTAAATATTAT 4080 
 4081 TATCATTTTAGTGGTTCTTTTATTTTATTTGCTGGTCAGAAAAGCTGATTTTTTCAATTA 4140 
 4141 GCGAAAATCCATCAAGTCATATTTCTATAGACTCTTTACTACATACGTTGATGACTTTCG 4200 
 4201 TGATTTTCTCCTTATCCGGTTCATCCATTCCAGCTTTATTATTGTTGAAAGTAAATAAGC 4260 
 4261 ATTGTTTCCCGAAAAAGAGCCGGATTTTGAAATTCGCGGAGAAAAAGTTGAAAATTGAAA 4320 
 4321 AATCCAAACGATGCTCCGATGTTCCGTCCGAAATGTGTGTTTTACCGTGACGGTGTTTGC 4380 
 4381 AGACAGCTTGAAAAAACATTTATTTTTTTATTTTAATTTTATTAATTTATTATTTATTTT 4440 
 4441 AGAATGTTCTATATTTTAAAATGTGAATTTGTTTCAGGGTACTCGGAATGTTTGTCTTAA 4500 
 4501 ACCGTTCAAGCGGGCTCATTCATCGATCTGTACCTTTATTAGCTCAAGTATCCACGCCTA 4560 
 4561 CGACTTCCACAACAAAATTAGGTTAATAATTCTCCATTTGGTGATAAACCAATTCTTTTC 4620 
 4621 TGCTTTTTTAAAACATTATGTTACAGCTCAACTTCACACAACGCATGCACTAAGCAAAGA 4680 
 4681 AGATTATTATAAGACTTTGGGTGTCGACAAAAAATCTGATGCAAAAGCAATCAAAAAGGC 4740 
 4741 TTATTTCCAGGTAATATAAGTTTTTATCGAATACTTTGTAAGTATAAATACGTTATTTCA 4800 
 4801 GCTTGCCAAGAAATACCATCCAGATGTAAACAAAACAAAAGAAGCGCAGACGAAATTTCA 4860 
 4861 AGAGATTTCTGAAGCATATGAGGTATTTTCAACAAACAATAGAGCAGGCTCGAATCAAAA 4920 
 4921 ATATTAAGGTACTTTCCGATGACACAAAACGTCAAGAATATGATGCATACGGAAGCGGAG 4980 
 4981 GTGGCCCAGCTGGTGGAAGAGGTGGTGCTGGAGGTTTCCACCACCATGGAAATGTTGATG 5040 
 5041 TTAACGAAATTTTCAGAAGAGCATTTGGTGGAGGGGGTGGAATGGTGAGTTCTCCTTATG 5100 
 5101 AATTCTTCTGAATATTATATTAATTATATAATTTTTATTGTAATTAATAAAAACTACAGT 5160 
 5161 TTTATTTATTTTTTCGCTGATTCCAGGGTGGCTTTAATTTTGATAATTTTGCCCAAAGTG 5220 
 5221 CTTTCGGACATTCTGCTGCTCAGGAAATGGTTATGGATATTTCGTTCGAAGAAGCTGTCC 5280 
 5281 GAGGAGCCACCAAAAATGTTTCTGTAAACGTAGTTGAAGATTGTCTGAAATGTCACGGAA 5340 
 5341 CTCAAGTTGAACCAGGTCACAAAAAGACGTCGTGTCCGTATTGTAACGGAACTGGAGCAG 5400 
 5401 TTTCTCAACGTCTTCAGGGTGGTTTCTTCTATCAAACAACTTGTAATCGATGCAGAGGAA 5460 
 5461 GTGGACATTATAATAAGGTAGAGTTATTGATTTTTCTTTTATTGTAGCTTTTAATTTTTT 5520 
 5521 CTTCAGAATCCTTGTCAAGAATGTGAAGGTGAAGGTCAAACCGTTCAACGACGTCAAGTA 5580 
 5581 TCATTCAATGTGCCAGCTGGAACTAATAATGGAGATAGTTTGAAGTTCCAAGTGGGGAAA 5640 
 5641 AATCAATTATTTGTTCGTTTCAACGTTGCACCATCTTTGAAATTCCGACGTGAGAAAGAT 5700 
 5701 GATATTCACTGTGACGTAGATATTTCTCTGGCTCAAGCTGTTCTTGGTGGTACTGTAAAG 5760 
 5761 GTTCCTGGAATTAATGGAGATACATATGTTCATATTCCGGCAGGAACTGGCAGTCACACT 5820 
 5821 AAAATGAGGTAATAAATCTCCAAAAATTGGAACTTAAATATTCATTAAACAATTTTCAGA 5880 
 5881 TTAACAGGAAAAGGAGTAAAACGATTGCATTCTTACGGAAATGGAGATCAATATATGCAT 5940 
 5941 ATTAAAGTAACGGTTCCGAAATATTTGACAGCCGAACAGAAACAAATTATGTTGGCTTGG 6000 
 6001 GCTGCGACGGAACAGCTGAAAGATGGAACCATCAAAGGATTGGAGAAAAATCAGAAAACC 6060 
 6061 GAGGAGAAGGAGACGAAGAAAAATGAGGAAAAGAAGTCTGAAGGTGAAAAAATATGATTT 6120 
 6121 CAATTTGAAACAAAGGTTTTATCAAAAAGTTGTCTTTAAAAAATCGAGAAATTACCAAAA 6180 
 6181 AAAATTCATTAATTTTTTTTTTTTAAACCGACATTATTGGTTGTAAAGATTCAAAAAGTT 6240 
 6241 TGTAAAATTTTAAAGTTGTTTGAAAAATACCTGAAAGTCTTGTTTTTTTTTTTGCATTCT 6300 
 6301 GATGCACTTGTAATCTCAATTTTTCCCCAAAACTGATTTTTGATTCTTTTCAATCCAAAA 6360 
 6361 TTACTAATTTATAGGTGCATCAGAATCACAAAAACGGAGAAGTGAGCCAGTAGCTGAGAA 6420 
 6421 TGCAGAAACTATTGACGAAAATCAAGAAAACGAGGGATTTTTCGAAAAAATTAAACGAAA 6480 
 6481 AATTTTCGGGTAAATATATAAATTTCTAAACAAAAATTAAATATTTTTGTTTCATTTGTA 6540 
 6541 TTAATTGAAATTTTCCAGATAAGTCCGAGGAGAAGTCCGAGTCAAAAGAAGAGCCAAAAA 6600 
 6601 ACGAAGAATCTAGTGAAACCCCCGAGAAAAAAGCTGCAGAATCCTAATATTTGTCGCAAT 6660 
 6661 TTATCGATTACTGTCCCAATCTTTCCAGTTTTGTTCCCTTGAAATTTGTTTTGTCTCATT 6720 
 6721 TGTAGTTCTATTAGAGTGATTATAGTGTCTTTTTTGTTACACTTGTTTTTTTTTTCTATT 6780 
 6781 TTCAATTAAACCGAAACAAATTTATCAAATTTTATTCAGAAAGAGATAACACAACTAGCA 6840 
 6841 ATGATATGAAGAGTTTTATGGATGAAACTGGATTTTTTTAGAAAATGGTCTGTAACTTGG 6900 
 6901 CTGAACATGAAAATATCAAAAACCTCAAAATTGATAAAATGTGGTAAAATGTTTTTCAGT 6960 
 6961 TTTACTACACAACAAAGATTTTTTTATGAAATTAGATGGATGTTGAGTTATGACTGGTAG 7020 
 7021 AACAGAAAAGTTTTCAAAAATTTTTGTGGATTTTGGTAAAATGGCTTTGACTCAATGTAA 7080 
 7081 CGCAACGAATAATTGGTATTTAAAAATGACAAAGATTTTAAAAGAAAGAAAAAACATTTC 7140 
 7141 TGATCATTATGTCAGTTGAACATTTGTTTCCTAGGCATTCATGTTTCAAGATACGCCAGT 7200 
 7201 TTGAAGATACGCAGTTTAGTGAGTTTAGGAAGTTATATTCTCATTACAAGCACAGGTACA 7260 
 7261 TGAGAAAACAGCAGTCAAAGAAGGGCGGTATTTTTTAATTTGGAATTATATTTTGCTCCT 7320 
 7321 TATAATATTGGGAACACATCTGTGCTGCTAAATTATTGTTTTGTTAATTTAAACCGAAAC 7380 
 7381 AAATTAATCAAAATTTATTGTAAAATAAAAATACAACTAGCAAAATATTTTATAGGACAA 7440 
 7441 AATATGAAAAACGGAATGTCGTGTGAAGATGGAATTGAAAAGATATGAAATCATTGTGAT 7500 
 7501 CTGTTCAGGCAAACTTTATAAAAAGCAAGGTTTTCGGGATAGTTTGAAAGAGCAGATCAC 7560 
 7561 CTGGATGTGAAAATACGGTGACATTTTTTTGGAAAAGGGAAAGAAAATGAAAAAAAATCG 7620 
 7621 ATAATTTATAGAAATTTTAGCCCGTTTTTAATTAGGGAAAGGGCGGTGAGTTAAGGATGT 7680 
 7681 GAAATAATTGAAATTTCAAAATGGAAAAGTGGTTTTTTTTGCACAGAATTTTTCATTTTT 7740 
 7741 CATCTTGAAGGTTATATTAAACACGCGATGACTGTATTTAGAACCCATTAAAATAATGGA 7800 
 7801 GAAAAATGTCTCAAAACTGAAATACTGATTTGAGAAAACCATTTTCCCTATTTGAAAACT 7860 
 7861 AAAAAAGATGACAAAATATAAAAATGGAAAATCTATTTGAATGCACGATTGAGAGAATAT 7920 
 7921 CTTGAATGACAAAATCTACAACTTTGCATATCAATTGCAGACGATGACGTGGAAATGGTA 7980 
 7981 GCAGCATCGGCAGTTTGATCAATATATCGAATACATCGGATATCAGTTGGTATGAATGGT 8040 
 8041 ATGATGTGTTTGGAAACATAGAGATTCTCCACTATAAAAGCTTCTCGGGACATGTTACGA 8100 
 8101 GCTCGCTTTTGCATTAAATTTGCGTAGAGTTCTGATACAAGGACTACCTGGAAATATTTC 8160 
 8161 AATTTTCCGTTGATCAACATAAAAAAGCAAAAAAAAATGCTTTTCAAAAAAGGCAAAAGT 8220 
 8221 TTTTTAAAAGTTTCAACTATATGCATATTTTTGACCACAAAACCAAAACAAAACAAACTC 8280 
 8281 AATAATATAAGTAAAGAAAACATTATGGAAATCATTTTCTCGCAAGGTCTTGTAAAACTA 8340 
 8341 AATCGCACTTGAAACTGACTATTTATATATATGAGAAAAATGAAGGAGTCCTCCAAAAAT 8400 
 8401 GATGCAACTCAAAAACGAAACATCAAAACGTATTTTTCAACATTTCGCATTTCGCATTAG 8460 
 8461 AGACATTTCGCATAGAACGGATTTATGTGGAAATTTATGGACGTTTTCGTCCTTTTTAGA 8520 
 8521 TACATGAGCACATGTTCTCCTGTTTTATTTAGAGAGATGACTTGCTTTCAAAATTAAAAA 8580 
 8581 AAAAAACTGCTTATACATACCTTTCCTCCTACAACCGCCAATGCAGATCTAGCGTCTTGA 8640 
 8641 ATTTTTCTTCCGAAATAATGAATCTTTCGAATATACTGTACTCCTACCAAATCAATGCAC 8700 
 8701 ATTGTAGTTATTGCAAGACCTAAAAATATTTTGAATTTTTGTTTTTTTTTCATTGAAAAT 8760 
 8761 TTACCTAAAATGATATAGAGCAATATGATATACATGTATCCGTCCCTTCTGGGCATCAAG 8820 
 8821 TCGCCAAACCCGACCTAAAAATATTAATTTCAAAGAGTTCAACAAACTGGAACAAATTAC 8880 
 8881 AGTAGTCATTGTAATGAAGGACCAGTAGAATGAAGTGAAGAAAGACCACGGCTCTAATTT 8940 
 8941 TGACATTAGGACACCGCCAAACGCTGTATATACTATCAGAATAGCTAATACCAGGAATGC 9000 
 9001 AGGAATTCTGGAAAGACAAAAATTGAGATGAGTGAATTAAGTTTTGAAAGGTAATTTTCA 9060 
 9061 AAATCCATTAAAAATGTATTAAAAATATTTTACAGTTTTCCAACGACCAAAAAATCTGTC 9120 
 9121 GAACATATACAAAAAACCAAAGCCAGCTTACAATGGAACCCCTAGTTTTTGTGATTGATC 9180 
 9181 GATTGTTTCATAAATGTGTTTTATAACATTACGAACAAAAAACGCTTCTTGACTGGCAAA 9240 
 9241 AACGTTTACCTTTTCTCCTCGATATTCATATCATGCCCCATTCCATGACTGTGACAGTGC 9300 
 9301 TCACAAACGTGCTCTCTCCGTTCTTTTCGATGTCGTGACAATATGAGATATTTTAATTTC 9360 
 9361 AAATAGTTTCCATACAACCAAACAAGATGTTCAGATAGGAATTTACCTGAAAATTATTAA 9420 
 9421 AATTATAATACATTTTCTACATTTTCCCTTTAAAAACAAATTTTAGATGCGATTAGCTGA 9480 
 9481 TCGCAGTAGCTATCAGATGTAACTGATGTTTTTTTAAAAACTTCACGTACTACAGATTTT 9540 
 9541 CTAGTAAAAGCATATAAGTGCCTGCCCACTTACCCAAGTCAGCGATGGTAACCAGTGTTA 9600 
 9601 GAGGTATTCCAAGCAAGGAGAACAATATACACCATATCCGTCCAATGTTTGTCACTGGAA 9660 
 9661 CTGGATTACCGTATCCGATGGTAGTGACGACGGTTACGGCAAAGAAAATGGACGATGAAA 9720 
 9721 ATGTCCATGTCTCCGTTGCTGCGTTCTTTTTTACCTGAAAATAAATTAAATTATTTTTGA 9780 
 9781 GGTATTTTGAGGTAGTATTATTGTATTAAAAGTTTGAATAATTTTGGTTGAATTTGGAAT 9840 
 9841 AGGTTGAAATCAAACTTTTCAAGTAAAAAACAAAGTTTCAATAGAAACAGTTTGAGAGAA 9900 
 9901 ATGATAAATAGCTGACCGGAAATGAGTACGAAAATCTACTTTTTAAACTTTGAGTATGCT 9960 
 9961 CTGAAATATTTTCCTGTTATTTCCTTTTTCCATATTCTGGCTTTCAATTATCTTTAAAAA 10020
10021 ATTTTAAAGACACATCTTGGTTAAGTGTTTGGTGAAACTATAAATCTAAAACTATTTTTA 10080
10081 AAGGAAAATCCTTGTCCCTTTGGATTAAAAAGAACAAGAATAATTTTGAAATGTTTAATT 10140
10141 ACAGACACAGACAATTGCTCAGTTAGCGCATAAAAAAATAAGCAGACAATGAACCAACAG 10200
10201 AACAAAAAACTTGAAAGGGTCTCTCTATCTGACAAGTTAGAGTTTTGTCATCTCCCGCGG 10260
10261 GAACAGCTGAGCTTTCTCCACTTGTTTTTGTCTAATCTCTCCACATTTTTCATGATCTAT 10320
10321 TGTTGTTTCTATCTTTTGATAGTCACAAGGGACCTCTTGTGTTTTCCGTTTCTATTTCAC 10380
10381 ACCGCCAAACAGACTCAAAGAATGGAAGGTTTTGTGGAAAAATAGGAAAAAGATGAATTG 10440
10441 GTGAGGATTATCAAGGATGGGGGAAAAGAGGTCGATAAGGAAATAGTTGGGTTAGAGAAG 10500
10501 AACAAATAATAGTCCGGGTAGTTTGGATGGTTCAGATGTTACTTCTATATTGATAAATTA 10560
10561 TAAGTTGTGTCGATGCAAAATGTTAATTTAAATAGCCGATCGTAGTTTGAAGCAATCAGT 10620
10621 TTACTGGTCAATTTCCGGCACATTTCGGCCAATTTTTGCCAAAATATTATATAAGTTTAG 10680
10681 TTAGAAAGTTTTCAAAGCTGGAAATAAATTCGGCAAGACTTGGCCTAGATTTCCAAGTTT 10740
10741 AGCTAAGCTTTGATTAAACTTCTGTCAATTTTTCATGAAAACTGTTCGTATTTTTTTATA 10800
10801 GGGTCGAAATCGGGATGCCTGGAGTTGTGCCCGGATTGAGAAAAAAATTTGCAAATAGCC 10860
10861 ATCTCAATTACTCAATTACAAATTGCTTGCAATACATTTTCCGTACCTTCTGGTCGTCAC 10920
10921 ATGCAATCTTTACAACAAAAAGTCCTGTCAAACTCACCTCGTTACTCGTCAAGAAATACT 10980
10981 TCTCAAATGCGACAAACAGCTGATCGGACATATTGTGCATGTGCCGTTCGGCTAGTGACT 11040
11041 CCCATTCGTATCGTTCTGCAGACAATTGTGTTCAGGAAATTTTGTGGATTTCCATTTTTT 11100
11101 GCCAGTTTGGTCGAATTATGTGTTGTAGGTATTGTCAAACAAGTTTCGTAAATTTGGCAA 11160
11161 TGTGCCAAAACTTTCAAAAAAAAAAAACAACGCTTTTAAAGTGTTTTAAAATACTTGGTC 11220
11221 AATCTGAATTAATATAATTGCATGTAAATCCCCACTACTGATATTAAAAAGTTATGCCAA 11280
11281 TCTAACTTACTTGTCTCATTTCCAGCAGCCAAACGAATTAAGTCGTCAACAAACTCATTT 11340
11341 TGACGAGTGTAGATCAGTTTAAGCTGAAAACTATTATTATTTTGAAAATTTCATATAATA 11400
11401 TTTCGAAATATTCATAGAAAGAAAACAATTGTGTCCACAAAAATGCTGTTGTAAATATAT 11460
11461 AATTAGGTGCACTCATGTGCTGCCAGGTTGTTCTTTGTTGAAAAATTCGATTTCAGGATG 11520
11521 CCATAAAGTAAATGGGAAAATATAATGGAATCTAACGCGACATTGTTTAAAATACTTTGG 11580
11581 CCGCTTGTGACGCCACACTGTTAAGTTTTAAAAATATATAAATTGATCCAAAAAAATTGA 11640
11641 AACTAACTATAAGCTTGACGAATAAAATCTAAGAGCCTAATATAAAAAAGAAGCTTTTTC 11700
11701 TCATGCTAGGTACTAAAAAAGGCGCCCGAAAAGCACCTGGCCACCGCAGCCTTTTTTCCA 11760
11761 GAAAATCGGAAGTCGTTCGCAAAGAAAATGGAAATGCTTGAGCCAACTGAGCCCATCTGC 11820
11821 CACGTCAATGAAATAGGCAGATGGCTGAATCGAACGGAAAAGAAGAAGGATGTGACGAGT 11880
11881 GAATGAATGGCTTTTTGCGTTGAAAAAGTACCACTTTTGGTAGAATAAGATGGGCGAGTG 11940
11941 GGAGTGAAGGAGTAGAAATAATAGAAATTGAAAATTGGAAACTTTTTCATAATTTTAACT 12000
12001 AGATTAATTTTAGATGTCAGAGATAAATCAAAATGTGCTTCAAAATAAAATAGTCTGAAA 12060
12061 TAGTCTTAATCCTTTTTATGCAAAATAAAAATTCGAACTTCCCCGAAATTCAAGTGGCAT 12120
12121 AATTGTTGCAATTTACACAGTAGTTTTGTGATTTTTGCGCCAAAAGACAAATTATTATCA 12180
12181 AGTGTGAAAAAAGTGTGCGCCTTTGAAGAGTACTGTAGTTCTAAACTCTTGTTGCTGCAG 12240
12241 GGTTTTTCAAAGTTTTTGTCATTTTTTTAATGTTTATCTTTATATTTTTAATTCATACAT 12300
12301 GTATTTTAAAAATATATTTTTAACAAAAACTGTGAAAAATCTAAATAGATTTCGCAGCAA 12360
12361 TGAGAGTTTGCAGTTACAGTTATTATATATCTTTAAAGGCACACACCTTTTTGAAATTAA 12420
12421 CAAACAATATCGAGTCGAGACCGCGTACCGTATTAATATCGCAAAACTTAGAGTTTTATT 12480
12481 TGTTTTTATCTTGATGAAAGGCTTTTCAGGAGAACGTTTTTTTTTCAAGAAGAATTATCA 12540
12541 CCTCTCTCACGAATTATCAACTCGTTCTCATTTTATTTCATTTTTAAGTGTACATACACA 12600
12601 TCGCTGTTAGTTACCATCGCACGGATGGCCGAGTGGTCTAAGGCGCCAGACTCAAGCGAA 12660
12661 ATGCTTGCCTCATGCTCGAGGTCGACTGGGTGTTCTGGTACTCGTATGGGTGCGTGGGTT 12720
12721 CGAATCCCACTTCGTGCAGAATTTTTTATGTTTTCAACCTTGACCAAAAGTCATATTCAT 12780
12781 CCAATTCGGTACCCTATTTCTACGTTATCTTGTTCCTCAAACGATGGCCTTATGTTTTGA 12840
12841 TCTTCAACACTGCATAAGGAAATGTATACCAAAGACGAAGGTCGTTTTGATTTTTCAGTA 12900
12901 ACTGGCAGCAATGATCCTTAAATCAGACTCCCACGCCCCTTCCGTTGAAAATAGGGCTTC 12960
12961 GATCGCCAAACTAATCTTATAAACACTAGAAAAGTTTTTGTTAAAAATCCGTATAAAAAG 13020
13021 GGAATAATGTGATGAAAAAAGGCATCAAATTTCAAATTTGAACATTTCAAGCTTAACTCG 13080
13081 AACTTCAGCTTTCTCGCGAAAAAATGAGTCAAATCTTCCAAATTCTTGTGATCTTCGCCA 13140
13141 TTTTGTCAGCATTGCAAGTGAATGGGTAGGTGAAGTACAGTACTTTATGGCATCAAATGA 13200
13201 AATATACTCAGATTCCTCTTTCCAACTTATTCGTCAGGATATGACTACGATTGTTATGGA 13260
13261 TACGGTAACAATGGTTACGGTAATGGTGGATACGGCTATGGAAATGGTGGCGGATACTAT 13320
13321 GGAGGATACAATGGATACTAAATAAAATAAATGAATACTTTTTGACGGATTTTTCATTGA 13380
13381 AAATTTATTTAATAAATGTTAAGCATTCATAAGTCTTGATGTAGCCTACCCTGAAGTATG 13440
13441 ATTTCGGACGGAATTATTAGGTGTAGGTCGTTTCCTACGTTTGCCTTATATGCAGGCAGG 13500
13501 CACGCCTTCGCGGAGATCAGGGGTGTATTTTTGCTATCGGGCAATCAAATGAAATATAGA 13560
13561 TTTGAAAAATTTTGTATTTTTTTTTTCTCTAAATGTTTTCAATTTTCAAGCTCAAAACAT 13620
13621 TTCAAGCCTAGAAGGAATTGTTTCAAATTTCTTCTCTCAAGTTGTGGAACTATTTCCAAT 13680
13681 ATAATATATTTATTCCAAATTACTCCCATGTGAACTATAGAACACGTATTGTCTCATCAT 13740
13741 TTCACTTTTATAGTTTCTGTATTACAACACTTGAATGAATGCTTGGTGTAAACAATTTAT 13800
13801 CAATGTGATAAACAATTCGATTTGACGAATTTTTCCGAATTCTCAGGATGACCGAGTTTC 13860
13861 GATGGTCAGTGGGAGTAAATGAATTGGGCAAATTGGTAATGGAAATCTAGTTTTTATGGT 13920
13921 GAGTCATGGCAAAGAAATCAAACATTTAAAAATTACAAGTGATAAACCATGAGTAAACTT 13980
13981 AATCAGGCAAGCTGGCGTTATCAAGTTGTTCAGTTGTTATAATAAAAATTACAAAAAAGA 14040
14041 TTTTCAAACAATGTAGATTTTTTCCACTATCAATATTCGGTAACTCAAAATAAGTCTCCG 14100
14101 TAGCATAGGACCTGGCAGCCTACACCTACATCTACATCTACATCTACACCTACCCACACT 14160
14161 ACAAGTACACCTAAATTAATGGTTCAAATGAGTCAAACTAACCTGTTGTTCCTTCATCAT 14220
14221 TTGCTCGTGCGGCTGCTCAACACTATAAAATATCAATGCTCCAATTACTGTATATGTACA 14280
14281 CGTTAGAAGTACAAGTGCAACATGAGGTAGGACGAGTTTAGCAAACTGAAATAGGAAAAT 14340
14341 CACTTCAATTAAAATATTAGAATAAATACTAAGTTTTCAATTTTTAATTAATTAATTTCA 14400
14401 ACGCGTTTGAATAATTTTGTTAAACTGTCGAGGAAAAAAATCTCATAGTCAGCGATCGAA 14460
14461 TTCTCACGAGTTCTGCCAATTTTTCCTTTTTTTTTAGATTCTTGTTTCCAATAGATTACC 14520
14521 TTCCTGATTCCAGTCTCCTCTTCTTCTTCATCTTCATCTTTACTTTCATCATCACTTTCA 14580
14581 TCGTCGATATCTTCATGGCCACTCTGAAAAGTTGTATTAACTTTTTAAAAATTCAACCAA 14640
14641 AAATAAAAATAAACAACTGTGTGAATCAAATGAAAAACTTTTAGTTAAAATTCTATAACA 14700
14701 TTGAAAATTGTATGAAACTAACAATAAAATCACACAGTTGACTATTTTCTTCAACGATCC 14760
14761 ATTTTTGCTAATGATTATAAAATGGTTAGCATAAAAATCCTTGTAAAATCAATAAAAACA 14820
14821 CACAAAATGGGTATATGGGAAAGGGGAATATAAATGAAAAATTCCATGCTTCTAATTCCA 14880
14881 AAACCTACTTAATAAACTCACAATTATGGCTGAAATCAAGCTGATTTCTAGCTCAACTTC 14940
14941 CTCATTTTCAATGAAAATTTTTGCAGATTTTTTCGATTTTTTTATTTTCCGATTTGCGTA 15000
15001 CGGACATTGATGAGGGTTATCTGGTGCTTCCTGTTTTACAAGAGTTTTACAAAATAGGGA 15060
15061 AAAGAGCAAAAGGCACAGTAAATCTTGTAAATTTAGAATTAATGAAAACAAACCTTATCA 15120
15121 CAACTGTGAATTAAATGACTATCTTCATAATATTCAGCTCTTCCAAGTCCAGCTCTTGTT 15180
15181 ACTTCTTCACCGAATAAAGCTTCCTGAAAATAAAGGGAAAAGGGCATGCAAACGTTTTTG 15240
15241 GAAAATCATGCAGTTTTTATTTTTATTTTCTAAGATGCATTTTATTGTCCACGGTGTTAA 15300
15301 CACCTGGTAACTCTATCTATATATGTTTTTTTTTGAAATTTCTTATACCTTTAGCTCTGG 15360
15361 TATACCTAATTTTTTTAAATATTAATTTTAAAAATTACATGCATTACTAACAGAGATAAT 15420
15421 TATTCTGATCATTAAAATTTTGTGATTGCTCTGGTCCTTGTAGATAAAAATAGACAAAAT 15480
15481 AATTACCCTCCTCAAAACTCTCAACTCTTCATCTGTTGCCACGTCATCTCCGTAAATCAA 15540
15541 GTTCTCAAAAATTTTAATATTATGATCAATTGAGCCATTATTATTTTCATAATGATCTGG 15600
15601 TTTTGTATAGCCACGTTTTTCATTTATAAAAAACTTTGCGATTCCAAAAAATTCCATTAT 15660
15661 GAAGAATTTGGAGACCGTGCTGAAAACATCCATCAAAATTGAGTTAAAGAAAATCGAAAT 15720
15721 AATTAAATGAAATTGAGTTGAACGTAGGATATTTATTAATTTGTTTTAAAATCAGTTTAA 15780
15781 AACCATTTTTGACGAATCTCAAAGCATTCAAAAATAAATAACAGAACATGGGAAAAATTG 15840
15841 TATGAGTTTATATAATACGTTTTCTCATGGTACTATTGATTGATCAGTGACAGAGTTTTC 15900
15901 GATTCAAATTATTATGTCGCCTTGATCAATGAACTGAATTTTCTGAAATCGTATGTCATA 15960
15961 CTATTTACTAAAACTTCACAAGTCATAAAAATCAAAATATCAAAAAAAAAGGATCTAGAG 16020
16021 AACTTTCAATTTTTCTCCGTTTCAAAAGTGTTTGCCAAAAACCGAAATGGGAGTACATTT 16080
16081 CTGAAGATTCCTTTTTTCTTTTTTGTTCAAAAAAAAGTTGTTAAGCTGGAAAAAAACTTT 16140
16141 GGTTTGAAGAGATGGAAGTTGTCTTGGACACACTCACATTTTTGATGGACAGCCTATCAG 16200
16201 CGAACCACTTTTGGATTCTTGGCGAGAAATTTTTGAATTTTCGAGTCAATTTTCATGTCT 16260
16261 AACTTGAGTATATTTATGACAGATATCACATTTTTCGAAAACAACAAAACAGAAATAAAA 16320
16321 ATTTATGAAAAACAGATTTTTTTCCGGATTTCAAAATTGTAAACTAGAATTTAGATTTTT 16380
16381 TCTATTAGTAATGCATACAACTTTTTGGAAGGAAAAATACTAGAATTTTAGTAAAATTTG 16440
16441 TTTTTTTTTAATTTTCTAATTTCTACAATTTTCCAAAACCATGCAAGAATCCATTCAATG 16500
16501 TCACCCAAAAAAGCAAAAGTCAAACAAGAAAAATCAATTAAAAAAAAGTTGAACCCTTTC 16560
16561 AATTTATACACTCACCCTTCTCTGCCGTCTATGAAATCCTTCTGGAATTTCAGTGACTCG 16620
16621 ATCATCCATCTCATGCCGTTCAAGTTCTTCATAGCTGTCATATTCAACTCCTACGTGGTG 16680
16681 GTATGTTGAAGCTGCAACAGAAAAATTGAACATCAAGTTATTTCTTACAGCTTGAACCTT 16740
16741 CAGCTCGCGCAGATTAAAAATTGGTAACTCCGTTGCAAAAAAGATGGAGTTGCGTTTTTG 16800
16801 GGAAGTTTTCAAGATTTCTTACTAAGAAGTTTGGTACTTCGGAGTTATGTTGAGTATAAT 16860
16861 AGGGCAACTACCCAAGTTTATTCTACCTTTAACAATCCTAACACTACTTACCGTAATCAT 16920
16921 CGTTATTACGATGAAGCAATGCTTCATGTGGATTATCACCTTCCTCTTCCATAAGTAGAC 16980
16981 TGCCACCATCACCACTAGAGTCAACTCGTTGATATCCACGAGATGATGAAGTCATCGCTG 17040
17041 ATGACGTGGCATCTGAAAACTCAATTAATTGATGTTAAATTAATTGTATTATAATATTAA 17100
17101 GTTCAACTTGAATTTTCTGAATGTATGGAAATTGAGCTTTTTTTTTAGCAAATCGCCATT 17160
17161 TTGAAAACTCTCATTTTCAAATAGGGTCTAAAAGAGACAAAAAGGCAATACCTGTTCATA 17220
17221 AGACACTGTTTGAAATTTTCAGTGAAAATTTTGGCAATATGCCAAAATTGCAAAAAACTA 17280
17281 CAAGTTATGATATAAGATGCTACGAGAAAAAATAAAAATGTAAATTTCAATCTACATCTT 17340
17341 CTAAAAATTGTAAGAACATCATGCAAAACCTGCAACAAAACCTTGAAAAATTGAAAGAAA 17400
17401 AAAGAAAGGTGAGGTAATCTGAGTCAAGGTGGAATGATGGAGGTTGGTGGGAAGAGGAAG 17460
17461 GAAATTCAAAACCGCATAGACACCAAATATTGCAATGTTTGACAGAGGGCGACGAGGAGA 17520
17521 GGAAAAAAACGAGATGAGCTCACGGGCGGAAAAAAGTTTTTTTGGAAGCGCTAAACTGAT 17580
17581 TAGTCAGTGGCGGTGGAGGAAGACCATTGGTATTGGATGGATAGCCCCCAATTTCGATGA 17640
17641 TTGACTTTTACACATATACACACCAAGCTTTTGTTTAGAAAAAAGAAACAAAGAATTGTG 17700
17701 TGTGTTGTAGGATGCCATTTTGAGGCGTGTGATTTGATAAATGAAGACTTCAACACCACT 17760
17761 ACTCCCTTGAGTCCAGATGAATTGAAGAACACGAAAAAACGATTTATAAACAGATGGTTT 17820
17821 CGTGTGGTTTCTGTGTTTTAAAAAGGCTGACCAAAAAACTTCTGTTTTACAGGACGATGT 17880
17881 GAGGGCTCTTCCAAGCTCGTTCTTTCCTCGCGCCTTACCGCAACTACCCATTAGTTTATC 17940